Protective Effects of Ginsenoside Rb1 in Rats with Diabetic Cardiomyopathy


*Corresponding Author:

F. Zhang

Department of Cardiology, Jinhua People’s Hospital, Jinhua, Zhejiang province 321000, China

E-mail:
[email protected]







Date of Received 25 June 2021
Date of Revision 10 August 2021
Date of Acceptance 08 June 2022
Indian J Pharm Sci 2022;84(3):723-729  

This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms

Abstract

Ginsenosides play an important role in the treatment of diabetes and obesity. Our group predicted that ginsenoside Rb1 combined with insulin would have a protective effect in diabetic cardiomyopathy. Diabetic model was established by high fat feeding combined with intraperitoneal injection of 70 mg/ kg streptozotocin in 8 w old male Sprague-Dawley rats. One rat was sacrificed at 8 w, 12 w and 14 w, respectively. The cardiac function and pathological structure of the myocardium were observed. It was concluded that the model of the diabetic cardiomyopathy group was successful. Rats were randomly divided into 4 groups and treated with different doses for 6 w. During this period, all rats received regular blood from the tail vein, had regular random blood glucose measurements and had regular fasting body weight measurements. After 6 w of intervention, cardiac ultrasonography was performed to evaluate cardiac function in all groups. Blood samples of aorta were collected for biochemical detection and pathological staining, immunohistochemical staining, reverse transcription polymerase chain reaction, Western blot and enzyme-linked immunosorbent assay were taken from heart tissue samples for detection. Compared with the normal group, diabetic cardiomyopathy rats displayed severe hyperglycemia, lower body weight, poorer cardiac performance, cardiac fibrosis and cardiac inflammation. Diabetic cardiomyopathy rats suffered obvious effects from over-activation of the heparin-binding epidermal growth factor pathway. Ginsenoside Rb1 treatment attenuated hyperglycemia, body weight loss and cardiac injury as well as heparin-binding epidermal growth factor activation induced by diabetic cardiomyopathy. Meanwhile, ginsenoside Rb1 had no obvious toxicity or side effects in the heart, liver or kidneys. Ginsenoside Rb1 treatment in diabetic rats can inhibit the over-activated heparin-binding epidermal growth factor signaling pathway, attenuate fibrosis of myocardial tissue and improve cardiac function, and has no obvious toxicity or side effects. It is a potential drug for diabetic heart disease.

Keywords

Ginsenoside Rb1, diabetic cardiomyopathy, heparin-binding epidermal growth factor pathway,
atherosclerosis, hypertension

Diabetes is a disease with one of the highest
incidence rates and death tolls in the world, affecting
approximately 422 million patients. By 2050, about 30
% of the United States of America (USA) population
will most likely suffer from diabetes[1]. Diabetes
has gradually become a major factor in the national
economy and everyday livelihoods in China, with
nearly 10.9 % morbidity in 2013[2]. Long-term diabetic
complications are considered to be largely the result of
vascular injury and can be divided into macrovascular
and microvascular complications[3]. 90 % of myocardial
blood supply comes from microvessels and the
remaining 10 % comes from the large blood vessels
on the epicardial surface. Diabetic Cardiomyopathy
(DCM) is defined as ventricular dysfunction without
coronary atherosclerosis and hypertension[4]. The
pathogenesis of DCM involves multiple mechanisms,
including metabolic and inflammatory imbalances, structural myocardial changes (fibrosis), peripheral
neuropathy and coronary microvascular dysfunction[5].
As one of the most common complications of diabetes,
DCM treatment is of great significance to prevent
diabetes-related mortality.

According to commonly accepted medical guidelines,
lifestyle interventions such as diet and exercise are
the foundation of diabetes treatment. If lifestyle
interventions fail, medication should be prescribed.
Oral drugs, insulin and insulin analogues are used
to treat Type 2 Diabetes (T2D). Some Chinese medicines and their natural active ingredients have a
hypoglycemic effect. Ginseng[6] is commonly used to
treat hemoptysis, hemostasis and hematoma in Chinese
traditional medicine. Ginsenoside Rb1 (the main
extract of ginseng) has the effect of improving insulin
sensitivity and may be used as an anti-diabetic drug.
As reported, ginseng and ginsenoside Rb1 can inhibit
weight gain[7], lower blood glucose[8,9] and improve
insulin sensitivity[10], results which may be achieved
by improving glucose tolerance in diabetic patients,
reducing liver fat accumulation, inhibiting lipolysis
of adipocytes[11] and regulating the development
and function of adipocytes[9,12,13]. These effects are
very beneficial for the treatment of diabetes and its
complications.

Following the literature, we speculated that ginsenoside
Rb1 could play an important role in treating DCM. This
study mainly explored the role of ginsenoside Rb1 and
its molecular mechanism in DCM.

Materials and Methods

Animal model and treatment:

Forty 8 w old male Sprague-Dawley (SD) rats were
randomly divided into two groups. The experimental
group was fed a high-fat diet for 6 w and the diabetic
model was induced by a single intraperitoneal injection
of streptin (Streptozotocin (STZ), 30 mg/kg, dissolved
in saline). Random blood glucose was measured using
a glucose meter (Roche, German). Rats with blood
glucose level >16.8 mmol/l were selected in DCM
group. It was diagnosed as T2D. If the blood glucose
is not up to the standard, the peripheral blood glucose
will be detected twice within 1 w. If the blood glucose
is still <16.8 mmol/l, the blood glucose will be kicked
out. Experimental group continues with high fat feed,
respectively in 8 w, 12 w and 14 w executed two rats,
observe the cardiac function and myocardial pathologic
structure, in w 12 echocardiographic indicates cardiac
function decline, pathological myocardial fibrosis, 14
w once again confirmed, that a DCM group building
success. The control group was intraperitoneally
injected with citrate buffer solution at 30 mg/kg. The
control group was fed with ordinary feed all the time.

Next, the DCM group was randomly divided into two
groups; one group was treated with insulin only and the
other group was treated with insulin and ginsenoside
Rb1. The normal group was randomly divided into
normal saline group and ginsenoside Rb1 group, with
6 cases in each group. Rats were kept in laminar flow cages where they were subjected to 12 h/12 h dark/
light cycles and had free access to standard food and
running water. 6 w later, we measured cardiac function.
The heart tissue and blood samples of the rats were
sacrificed for histological and molecular analysis. The
research was approved by the Institutional Animal Care
Use Committee of Jinhua People’s Hospital.

Cardiac function measurement:

Echocardiography was carried out using a Vivid 7
ultrasound system with a 10-MHz transducer (General
Electric, USA). Rats were anesthetized by inhalation
of 2 % isoflurane in oxygen, Left Ventricular End-Diastolic Diameter (LVEDD) and Left Ventricular
End-Systolic Diameter (LVESD) were measured on
the parasternal left ventricular long-axis view. These
chamber dimensions were indexed to body weight. Left
Ventricular Ejection Fraction (LVEF) and Fractional
Shortening (FS) were calculated by assuming a
spherical left ventricular geometry for the ultrasound
system algorithms. The data above was measured
at least three times and averaged. All measurements
were operated by an experienced investigator who was
blinded to the grouping.

Histopathology:

Heart samples were fixed by formalin and embedded in
paraffin. For Hematoxylin and Eosin (HE) staining, the
3 μm tissue sections were deparaffinized and stained
with HE stain. For Masson staining, the heart sections
were deparaffinized and incubated with 100 μl of
Masson staining solution for 5 min. Then the sections
were washed with distilled water, incubated with 100
μl of phosphomolybdic acid reagent for 5 min and
incubated with 100 μl of aniline blue for 5 min. After
treatment with 100 μl of differentiation solution for 30-60 s, sections were dehydrated with gradient ethanol,
made transparent with xylene and then sealed.

Human Heparin-Binging Epidermal Growth Factor
(HB-EGF) Enzyme-Linked Immunosorbent Assay
(ELISA):

A Human HB-EGF ELISA kit (Elabscience, China)
was used to test for the activity of HB-EGF in plasma,
according to the manufacturer’s instructions.

Ribonucleic Acid (RNA) isolation and Reverse
Transcription quantitative Polymerase Chain
Reaction (RT-qPCR):

Total RNA was extracted by TRIzol reagent (Invitrogen, USA) and reverse-transcribed using a PrimeScript
RT reagent kit with genomic Deoxyribonucleic
Acid (gDNA) eraser (Takara, Japan) according to
the manufacturer’s instructions. In addition, PCR
was carried out with FastStart™ Universal SYBR
Green Master (ROX) (Roche, German) using the
ABI 7900 System (Applied Biosystems, USA)
according to the manufacturer’s instructions. Beta
(β)-actin was chosen as an internal control. The
primers used for RT-qPCR are Interleukin-6 (IL-6)
forward: CTGCAAGAGACTTCCATCCAG; reverse:
AGTGGTATAGACAGGTCTGTTGG; β-actin
forward: GTTGGAGCAAACATCCCCCA and
reverse: ACGCGACCATCCTCCTCTTA.

Western blot:

Samples were disintegrated by
Radioimmunoprecipitation Assay (RIPA) buffer and
quantified with a Bicinchoninic Acid (BCA) assay kit
(Pierce, USA). Total protein was isolated within sodium
dodecyl-sulfate polyacrylamide gel by electrophoresis
after denaturation and transferred to polyvinylidene
fluoride membranes. The bands were blocked using 5
% non-fat milk for 1 h and then incubated with primary
antibodies overnight. Then, the bands were incubated
with secondary antibodies. Proteins were detected using an Enhanced Chemiluminescence (ECL) kit
(CST, USA). The HB-EGF antibody used for Western
blot was purchased from Abcam (UK).

Statistical analysis:

Statistical analysis was conducted using Statistical
Package for the Social Sciences (SPSS) 20.0 for
Windows (SPSS Inc., USA). Continuous variables were
expressed as the mean±standard deviation. Categorical
variables were analyzed by the Chi-square (χ2) test and
continuous variables were analyzed by the t-test.

Results and Discussion

When the DCM model was induced, the rats in both
diabetic groups displayed severe hyperglycemia, lower
body weight and higher levels of total cholesterol
and triglycerides compared to non-diabetic groups as
shown in Table 1. We also measured body weight and
blood glucose weekly during the study. Comparing the
diabetic group treated with ginsenoside Rb1 to the group
treated only with insulin, we found that ginsenoside Rb1
significantly suppressed hyperglycemia and weight loss
(p<0.001). Meanwhile, ginsenoside Rb1 had no obvious
effects on normal rats measured by blood glucose and
body weight as shown in fig. 1.






          Blood glucose (mmol/l) Body weight (g) Total cholesterol (mmol/l) Triglyceride (mmol/l)
DCM 20.3±2.5*** 444.3±36.5*** 16.3±3.9*** 6.3±1.9***
NC 6.2±1.3 485.8±22.5 4.6±0.5 0.9±0.3

Table 1: Characterization of Animal Groups

Random

Fig. 1: Characterization of animal groups during the experiment, (A): Random blood glucose measured by blood taken from the
tail vein per week and (B): Body weight measured per week

Note: Compared to DCM, ***p<0.001; compared to NC, #no significant differences,

At the end of the experiment, the rats in each group
underwent cardiac ultrasound to evaluate cardiac
performance. The results showed that the LVEDD
and LVESD of the heart tissue in the DCM group
were smaller than in the control group. Meanwhile,
the myocardial echo in the DCM group was uneven
and disordered. Thus, ginsenoside Rb1 improved the
cardiac function of DCM rats but had no obvious effects
on the heart tissue of normal rats as shown in fig. 2 and Table 2.








  LVEDD (mm) LVEDD index LVESD (mm) LVESD index LVEF (%) FS (%)
NC 6.3±0.7 14.6±1.4 3.9±0.4 8.5±0.5 79.8±3.4 51.3±3.0
Rb1 6.4±0.8 14.8±1.0 3.8±0.3 7.9±0.6 80.4±4.9 50.3±3.7
DCM 5.5±0.5 21.3±2.1*** 4.0±0.5 14.0±1.7*** 67.6±6.0*** 38.8±2.7***
DCM+Rb1 6.2±0.5 19.8±1.5 3.9±0.4 10.4±1.4*** 71.3±6.3### 44.6±3.8###

Table 2: Cardiac Performance by Cardiac Ultrasound

Ginsenoside

Fig. 2: Ginsenoside Rb1 attenuated cardiac performance in DCM rats

At the end of the experiment, cardiac fibrosis was
measured by HE and Masson staining in the myocardial
tissue. The myocardial cells in the control group
were neatly arranged with uniform nuclei and tightly
connected and the myocardial cells in the DCM group
were swollen, disordered and fibrotic. Ginsenoside
Rb1 reduced the pathological changes of myocardial
tissue in DCM rats, but had no significant effect on the
myocardial tissue of normal rats as shown in fig. 3.

attenuated

Fig. 3: Ginsenoside Rb1 attenuated cardiac inflammation in DCM rats with HE and Masson staining in heart tissue

At the end of the experiment, cardiac inflammation was
measured by the expression of IL-6 messenger RNA
(mRNA) in the myocardial tissue. IL-6 levels in the
DCM group were significantly higher than in the control
group, but ginsenoside Rb1 suppressed IL-6 expression in DCM rats. Meanwhile, it had no significant effect on
IL-6 expression in normal rats as shown in fig. 4A.

inflammation

Fig. 4: Ginsenoside Rb1 attenuated inflammation and suppressed the HB-EGF pathway in DCM rats, (A): RNA expressions of IL6
as determined by quantitative real-time RT-PCR; (B): Protein expressions of HB-EGF in serum as determined by ELISA and (C):
Protein expressions of HB-EGF in heart tissue as determined by Western blot

Note: Compared to NC, ***p<0.001 and compared to DCM, ###p<0.001

At the end of the experiment, the blood samples from
each group of rats were examined for HB-EGF by
ELISA. The results were serum HB-EGF level of rats in
the DCM group was significantly higher than that of the
control group; ginsenoside Rb1 appeared to suppress
serum HB-EGF levels in DCM rats. In addition, it had
no significant effect on serum HB-EGF levels in normal
rats as shown in fig. 4B. The expression of HB-EGF in
the myocardial tissue was measured by Western blot,
with similar results to the serum HB-EGF as shown in fig. 4C.

At the end of the experiment, the serum Creatine Kinase-MB (CK-MB), Alanine Transaminase (ALT) and
Creatinine (Cr) levels of DCM rats were significantly
higher than those of the control group. However,
ginsenoside Rb1 apparently reduced these levels in
diabetic rats. Ginsenoside Rb1 had no obvious effect on
the serum CK-MB, ALT and Cr levels of normal rats.
The results also indicated that ginsenoside Rb1 had no
significant liver, kidney or cardiotoxicity at the selected
dose as shown in Table 3.








  ALT (U/l) Cr (U/l) CK-MB (U/l)
NC 31.9±5.9 50.8±6.9 540.2±53.2
Rb1 29.6±6.4 50.0±7.3 562.7±59.4
DCM 114.6±36.7*** 54.4±8.9 754.7±115.6***
DCM+Rb1 71.4±16.6### 54.7±11.8 625.7±108.9###

Table 3: Safety of Ginsenoside Rb1 Treatment

DCM is one of the most serious cardiovascular
complications of diabetes and is highly correlated with
the incidence of heart failure and patient mortality.
It is difficult to prevent DCM because of unclear
pathogenesis. However, diabetes is considered an
inflammatory disease and inflammatory factors play
an important role in the development of diabetes and
its cardiovascular complications[14-18]. In the present
study, the inflammatory signaling pathway in the
myocardial tissue of the DCM group was significantly
activated, showing that the level of inflammatory factor
(IL6) mRNA was significantly increased. Meanwhile,
the ginsenoside Rb1 intervention can relieve the
inflammatory response in DCM rats, suggesting that
ginsenoside Rb1 may have the effect of inhibiting the
inflammatory response while simultaneously helping
insulin to lower blood glucose. Myocardial fibrosis is
another characteristic pathological change in DCM. In
the diabetic state, a large amount of collagen deposition
in the interstitium of the myocardium increases the
stiffness of the ventricle and decreases the compliance,
which may eventually lead to ventricular diastolic and
systolic dysfunction[19-22]. In this study, we also observed
that the degree of myocardial fibrosis in diabetic rats
treated with ginsenoside Rb1 was reduced.

HB-EGF is named for its role in promoting
growth and is abnormally activated in diabetes and
atherosclerosis[23]. It has been reported that high blood
glucose can lead to elevated HB-EGF and thus to
abnormal phosphorylation of HB-EGFR, resulting
in oxidative stress and endothelial dysfunction[24].
STZ induced mouse diabetes models with subsequent
endothelial dysfunction have been widely reported[25-27].
In addition, the serum HB-EGF concentration of
diabetic patients is higher than that of normal patients,
which is consistent with previous studies[28-30]. Our
results confirm that the abnormal expression of HBEGF
in the diabetes model plays an important role in
cardiovascular complications. Meanwhile, inhibition
of HB-EGFR activation[25,31,32] or reduction of insulin
resistance[33] can reverse these phenomena. Our results
indicate that HB-EGF levels in the myocardium and
serum of DCM rats are significantly increased and that
ginsenoside Rb1 can reduce them effectively.

Rb1 ginsenosides are extracts of the traditional Chinese
medicinal herb ginseng and more information is needed
on their safety. We measured serum CK-MB levels to
assess heart injury, serum Cr levels to assess kidney
injury and serum ALT levels to assess liver injury.
The results reveal that the levels of serum CK-MB, Cr and ALT in the DCM group were significantly higher
than those in the Normal Control (NC) group, while
ginsenoside Rb1 intervention reduced serum CKMB,
Cr and ALT levels. Meanwhile, in the NC group,
ginsenoside Rb1 intervention had no significant effect
on serum CK-MB, Cr or ALT levels. These results
indicate that ginsenoside Rb1 has no obvious toxicity
or side effects in a rat’s heart, liver or kidneys at the
selected dose in this research and is a safe drug of
choice.

In summary, ginsenoside Rb1 treatment significantly
attenuates cardiac inflammation and fibrosis by
inhibiting the activity and expression of HB-EGF,
leading to improved cardiac function in DCM rats.
Our results indicate that ginsenoside Rb1 might have
therapeutic potential for the prevention and treatment
of DCM.

Acknowledgements:

This research was supported by Jinhua Science and
Technology Project (No: 2018-4-051).

Ethical approval and consent to participate:

All methods were carried out in accordance with
relevant guidelines and regulations. And this article
was approved by the Ethics Committee of Jinhua
people’s Hospital.

Conflict of interests:

The authors declared no conflicts of interest.

References



Source link

Published by Indian Journal of Pharmaceutical Sciences

Profile Managed by Pharma Enthusiast for Community Benefit
Indian Journal of Pharmaceutical Sciences (0250-474X), is the official scientific publication of the Indian Pharmaceutical Association. It started in 1939 as the Indian Journal of Pharmacy. The journal is published Bimonthly. https://www.ijpsonline.com/

Get Connected!
Come and join Pharma Community. Expand your network in Pharma!

Comments

No comments yet